[PCR]#1 Lamda phage DNA 증폭 실험

관리자
2021-03-05
조회수 455

1. 개요 및 목적


1. 개요 및 목적

Lamda Phagegenome을 사용하여 PCR의 기초를 탐구할 수 있다.

세 개의 다른 프라이머(primer) 세트를 사용하여 Lambda Phage genome의 세부분을 증폭시키고, 

genome 조각의 크기(염기서열의 길이)별로 구별할 수 있다.

2. 실험 재료 및 기


2. 실험 재료 및 기기

실험 재료 


        ▼  본 실험에서 사용한 primer 1, primer 2, primer 3의 서열 정보

              P1_F: GAAGCGTTTATGCGGAAGAG

              P1_R: CGTTGCGTTTGTTTGCAC


              P2_F: GAAGCGTTTATGCGGAAGAG

              P2_R: ACCTGCTGATCTGCGACTTA

 

              P3_F: GAAGCGTTTATGCGGAAGAG

              P3_R: TGACTCCTGTTGATAGATCCAGT


실험 기기

  • Conventional PCR (본 실험에서 사용한 기기 → DuxCycler (주)바이오메듀스,한국)
  • DNA Electrophoresis (본 실험에서 사용한 기기 → DuxGelDoc- (주)바이오메듀스,한국)

3. 실험 방법 


3. 실험 방법 및 절차

1) 샘플을 준비한다.


Sample 1
Sample 2
Sample 3
Sample 4 (NC)
2X Master Mix
10uL
10uL
10uL
10uL
Primer Set
P1: 4uL
P2: 4uL
P3: 4uL
-
Lambda DNA
3uL
3uL
3uL
3uL
dH2O
3uL
3uL
3uL
7uL
Total
20uL
20uL
20uL
20uL


2) PCR 조건에 맞춰 기기를 세팅한다.

단계
온도
시간
반복 사이클
초기 변성*
95℃
05:00
1
변성
95℃
00:30
30
결합
58℃ 
00:30
신장
72℃ 
01:00
최종 신장*
72℃ 
05:00
1

4℃**

* 주형 (target) DNA의 완전한 변성(denaturation)을 위하여 처음에 5분 정도의 충분한 초기 변성 시간을 주는 것이 좋습니다. 이는 변성이 충분하지 않으면          primer의 결합(annealing)과 신장(elongation)이 방해받아 정확한 반응물이 생기지 않을 수 있기 때문입니다. 신장도 같은 이유로 5분 정도의 충분한 최종 신장       시간을 주는 것이 좋습니다.

** PCR이 끝난 후 산물이 변성없이 제일 안정적으로 유지될 수 있는 온도입니다.


3) PCR이 끝난 후 전기영동으로 증폭된 PCR 산물을 확인한다.

     (1) 아가로스 겔 만들기

           ① 삼각 플라스크에 0.5X TBE buffer와 아가로스 powder를 넣고 잘 섞어준다.

DNA 시료의 크기 범위
아가로스겔의 농도 (w/v)
TAE 버퍼
아가로스
1kb~30kb
0.5%
20mL
0.10g
800bp~12kb
0.7%
20mL
0.14g
500bp~10kb
1.0%
20mL
0.20g
400bp~7kb
1.2%
20mL
0.24g
200bp~3kb
1.5%
20mL
0.30g
50bp~2kb
2.0%
20mL
0.40g

[DNA 크기에 따른 아가로스겔의 농도]
 

        2. 삼각 플라스크를 전자레인지에 넣고 1~2분 가량 돌려 powder를 완전히 녹인다.

        3. 겔 플레이트에 comb (Sample을 로딩할 수 있는 웰을 만들어줌)를 꽂고 녹인 아가로스를 부어 굳힌다.

4. 실험 결과


4. 실험 결과

M
1
2
3
4
M

[사진1] 실험결과 예시



Lane

M
100bp DNA Ladder
1
Primer set 1 사용 DNA (202bp)
2
Primer set 2 사용 DNA (304bp)
3
Primer set 3 사용 DNA (501bp)
4
Negative Control


▲ 실험결과 예시 이미지 (이미지 촬영: DuxGeldoc - (주)바이오메듀스)

5. 주의사항


5. 주의 사항

① 실험도구 및 테이블을 소독하여 오염원을 제거한다.

② 한 Tube에 목표한 프라이머만 들어가도록 정확하게 실험한다.

6. 관련 자료


6. 관련 자료


#PCR #Conventional PCR #Lambda Phage #DNA #Nucleic Acid Amplification #Electrophoresis



* 본 실험에 사용된 Lamda phage DNA는 (주)바이오메듀스의 교육용 PCR Kit를 사용했습니다.






이경진 연구원


 경기도 수원시 영통구 대학4로 17 (이의동) 에이스광교타워1 3층 308호

Tel.(+82)031-899-8620 Fax.(+82)031-899-8621

E-mail. biomedux@biomedux.com




1 2