[PCR]#2 K562 DNA 증폭 검출 실험

관리자
2021-03-25
조회수 551

1.개요 및 목적


1. 개요 및 목적

K562 cell에서 DNA를 추출해보고, 추출한 DNA로 PCR을 통한 유전자 증폭 및 검출 실험을 한다. 

이 실험을 통해 DNA 추출 방법과 각 추출 시약의 역할에 대해 알아볼 수 있다.

2. 실험 재료 및 기기


2. 실험 재료 및 기기

실험 재료

1) DNA추출시약

시약역할
AVL bufferLysis buffer 제품이다. (Qiagen, 독일)
Cell을 lysis(분해,용해)시킨다.
Proteinase K세포분해 시 만들어진 불필요한 단백질을 분해시킨다.
100% EthanolDNA를 농축, 침전시켜 beads에 잘 붙게해준다.
MagAttract Suspension G (Beads)자기 비드 용액 제품이다. (Qiagen, 독일)
세포로부터 분해된 DNA를 표면에 붙여 모아준다.
AW1 buffer,
AW2 buffer
washing buffer 제품이다. (Qiagen, 독일)
Beads에 붙은 DNA에서 불필요한 요소들을 씻어준다.
AE bufferelution buffer 제품이다. (Qiagen, 독일)
실험 마지막 단계에 beads에 붙어있는 DNA를 녹여 떼어낸다.


2) PCR 시약

DNA Polymerase 2X Master mix, Primer set、K562 DNA, dH2O, DNA Ladder(100bp)


  • 본 실험에서 사용한 프라이머(primer)의 서열 정보 (논문참고)

F: TCAGTATGTGACTTGGATTG

R: GATAAATACATAGGATGGATGG


실험 기기

Conventional PCR (ex.DuxCycler- 바이오메듀스,한국)

DNA Electrophoresis (ex.DuxGeldoc- 바이오메듀스,한국)

3. 실험 방법 및 절차


3. 실험 방법 및 절차

1) DNA 추출 (QIAamp DNA kit 참고)

Sample 200uL에 Proteinase K 20uL를 넣어 준비한다.

100% Ethanol 200uL 에 MagAttract Suspension G(beads) 25uL를 넣어 sample 수 만큼 준비한다.

③ ①의 tube에 AVL buffer를 200uL 넣어주고, vortexing 15~30sec 한다.

④ ③의 tube에 2.tube의 시약을 넣어주고, vortexing 15~30sec 한다.

Magnet으로 sample안의 beads를 1~2min정도 모아준 후, 용액만 살짝 따서 버려준다.

AW1 buffer를 500uL 넣어주고, vortexing 15~30sec 한다.

⑦ Magnet으로 sample안의 beads를 1~2min정도 모아준 후, 용액만 살짝 따서 버려준다.

AW2 buffer를 500uL 넣어주고, vortexing 15~30sec 한다.

Magnet으로 sample안의 beads를 1~2min정도 모아준 후, 용액만 살짝 따서 버려준다.

Sample의 뚜껑을 연채로 1~2분 건조시킨다.

AE buffer를 500uL 넣어주고, vortexing 15~30sec 한 후 1min 실온에서 기다린다.

Magnet으로 sample안의 beads를 1~2min정도 모아준 후 *새 용액을 모아준다.


2) PCR 샘플 시약 조성


Sample
NC
2X Master Mix
10uL
10uL 
Primer Set
1uL 
1uL 
K562 DNA
6uL 
-
dH2O
3uL 
9uL 
Total
20uL 
20uL 


3) PCR 조건에 맞춰 기기를 세팅한다.

단계
온도
시간
반복 사이클
초기 변성
95℃
05:00
1
변성
95℃
00:30
35 ***
결합
55℃ ***
00:30
신장
72℃ 
01:00
최종 신장
72℃ 
05:00
1

4℃

*** 각 실험마다 사용하는 Master mix가 있습니다. 각 Master mix엔 권장하는 온도, 시간, 사이클 수가 있는데 그 범위내에서 실험을 해보게 됩니다. 실험에서 사용하는 DNA의 크기나 primer의 길이 등 영향을 주는 요소에 따라 잘 맞는 조건을 찾아서 정하게 됩니다.


4) PCR이 끝난 후 전기영동으로 증폭된 PCR 산물을 확인한다.

4. 실험 결과


4. 실험 결과

(▲이미지 촬영: DuxGeldoc - (주)바이오메듀스)

Lane

M
100bp DNA Ladder
1
K562 DNA (116bp)
2
Negative Control

5.주의사항


5. 주의 사항

1) 실험 도중 DNA나 PCR 시약이 오염되지 않도록 파이펫팅에 주의를 기울인다.

2) 실험 방법 중 온도나 시약 양을 틀리지 않게 주의하여 실험한다.

6. 관련 자료


6. 관련 자료 (첨부파일)

  • Advantages of Thermococcus kodakaraenis(KOD) DNA Polymerase for PCR-Mass Spectrometry-Based Analyses© 2003 American Society for Mass Spectrometry. Published by Elsevier Science Inc.



#K562 DNA #DNA Extraction #Conventianal PCR






이경진 연구원


 경기도 수원시 영통구 대학4로 17 (이의동) 에이스광교타워1 3층 308호

Tel.(+82)031-899-8620 Fax.(+82)031-899-8621

E-mail. biomedux@biomedux.com




1 2