[PCR]#5 CTNG Multiplex PCR

관리자
2021-04-09
조회수 500

목차

1.개요 및 목적

2. 실험 재료 및 기기

3. 실험 방법 및 절차

4. 실험 결과

5. 주의 사항

1. 개요 및 목적  


1. 개요 및 목적

앞의 실험에서 진행한 Chlamydia trachomatis(CT)와 Neisseia gonorrhoeae(NG)의 DNA를 갖고 *Multiplex PCR 실험을 통해 한 실험에서 두 개의 DNA를 동시에 증폭시켜 본다.

*Multiplex PCR이란?? Multiplex란 1개의 샘플에서 2-4개의 타겟들을 검출하는 기법을 의미한다. Real time PCR의 경우는 Probe에 형광물질을 각각 다르게 하여서 진행하고, Conventional PCR의 경우는 증폭산물의 크기를 다르게 하여 진행한다.

*Multiplex PCR의 사용: Multiplex PCR은 동일한 샘플에서 검출 가능한 다수의 유전자가 있을 경우 유용하게 사용되며, 한번의 검사로 다수의 병원균 및 유전자형을 판별할 수 있어 시간과 비용을 줄일 수 있다. 한번의 검사로 다수의 성병 원인균을 검출할 수 있는 STD 진단키트, HPV 감염 여부 및 유전자형 판별, 결핵균의 감염 여부와 약제 내성을 판별하는데 사용되고 있다. 또한 STR 마커를 이용하여 법의학, 친자 확인 등에도 사용된다.

2.실험 재료 및 기기


2. 실험 재료 및 기기

실험 재료

TaqMan Gene expression master mix, CT&NG Primer set (Forward, Reverse), Probe, CT DNA, NG DNA, dH2O

 

  • Primer 정보

CT_F: GCGGGCGATTTGCCTTA

CT_R: CGGTCAACGAAGAGGTTTTGTC

NG_F: CCTTTGGTCTTGGTTTCCAACA

NG_R: TCATAGCGATATGGAGCGTCAA

 

  • Probe 정보

CT_P: CGGAGCGAGTTACG-**FAM

NG_P: CTCTGCTTCGGCTCT-**HEX

**Real time PCR 장비는 기본적으로 다양한 파장대의 형광값을 실시간으로 측정하여 결과로 나타내는 방식이다. Multiplex PCR은 이를 토대로 파장의 범위 별로 다른 형광을 종류별로 정해 각 타켓의 Probe에 붙여주는 것이다.

파장예시 표:

Filter
흡수 파장
방출 파장
형광
1
490nm
520nm
FAM, SYBR Green Ⅰ
2
520nm
550nm

3
550nm
580nm

4
580nm
610nm

5
630nm
680nm


실험 기기 

Real time PCR Machine (QuantStudio5, ABI, Thermo Fisher Scientific, 미국)

3. 실험 방법 및 절차


3. 실험 방법 및 절차

CT&NG DNA를 10배씩 희석하여 준비한다.


Sample 1
Sample 2
Sample 3
Sample 4
Sample 5
DNA
CT 2uL
Sample 1의 DNA 2uL
Sample 2의 DNA 2uL
Sample 3의 DNA 2uL
Sample 4의 DNA 2uL
NG 2uL
dH2O
16uL
18uL
18uL
18uL
18uL
Total
20uL
20uL
20uL
20uL
20uL


PCR 샘플 시약 조성

 
Sample 1 ~ 5
N.C.
Master Mix
10uL
10uL
Primer Set
5uL
5uL
CT&NG DNA
3uL
-
dH2O
2uL
5uL
Total
20uL
20uL


③ PCR 조건에 맞춰 기기를 세팅한다.

단계
온도
시간
사이클
초기 변성
50℃
02:00
1
변성
95℃
10:00
1
결합
95℃
00:15
40
신장
60℃
01:00


④ PCR이 끝난 후 그래프를 확인한다.

4. 실험 결과


4. 실험 결과

5. 주의 사항


5. 주의 사항

① 타겟이 여러 개이고 그에 따라 여러 개의 형광을 사용하기 때문에 서로의 형광 파장 때에 영향이 없도록 probe를 디자인하여야 한다.

② Real time PCR 기기로 실험 시 형광을 설정하는데 각 타겟에 알맞은 형광을 잘 선택하여 실수가 없도록 해야 한다.


#Multiplex PCR #FAM #HEX




이경진 연구원


경기도 수원시 영통구 대학4로 17 (이의동) 에이스광교타워1 3층 308호

Tel.(+82)031-899-8620 Fax.(+82)031-899-8621

E-mail.biomedux@biomedux.com


3 0