[PCR]#8 HPV PCR 실험

이경진
2021-04-28
조회수 567


목차

1.개요 및 목적

2. 실험 재료 및 기기

3. 실험 방법 및 절차

4. 실험 결과

5. 주의 사항


1. 개요 및 목적 


1. 개요 및 목적

HPV(Human papillomavirus)는 인간 유두종바이러스라고 하며 DNA 기반의 바이러스로 사람을 비롯한 여러 동물의 피부나 피하에 감염된다.

현재 130여종의 바이러스가 발견되었으며 그 중 HPV16, 18이 전 세계 자궁경부암 환자의 70%에서 발견되고 있는 고위험군이다.

Conventional PCR을 통해 이 두 타입의 DNA를 증폭시키고 전기영동을 통해 결과를 확인해 볼 수 있다.


2.실험 재료 및 기기


2. 실험 재료 및 기기

실험 재료

*Taq polymerase (1unit/ul), 10X taq buffer, **dNTP mix (25mM),  HPV Primer set (Forward, Reverse), HPV16, 18 DNA, dH2O, 

  DNA ladder

*Taq polymerase: Thermus aquaticus라는 미생물에서 유래한 중합효소로 열에 안정적이며 DNA를 합성하는 효소이다.

**dNTP: 핵산의 구성 성분으로 중합효소가 DNA를 합성할 때 기질 역할을 한다. dNTP는 단순한 PCR 반응의 구성 요소 역할 뿐 아니라 중합효소가

 핵산을 합성하는데 필요한 에너지를 제공하는 역할도 한다.


  • Primer 정보

HPV_F: TTTGTTACTGTGGTAGATACCAC

HPV_R: GAAAAATAAACTGTAAATCATATTC


실험 기기

Conventional PCR (ex.DuxCycler-바이오메듀스)

DNA Electrophoresis (ex.DuxGeldoc- 바이오메듀스,한국)


3. 실험 방법 및 절차


3. 실험 방법 및 절차

① HPV16, 18 DNA를 10배씩 희석하여 준비한다.


Sample 1Sample 2Sample 3Sample 4Sample 5Sample 6Sample 7
DNADNA 2ulSample 1의
DNA 2ul
Sample 2의
DNA 2ul
Sample 3의
DNA 2ul
Sample 4의
DNA 2ul
Sample 5의
DNA 2ul
Sample 6의
DNA 2ul
dH2O18ul18ul18ul18ul18ul18ul18ul
Total20ul20ul20ul20ul20ul20ul20ul

 

② PCR 샘플 시약 조성 


Sample 1~7N.C.
Taq polymerase0.5ul0.5ul
10X taq buffer2ul2ul
dNTP0.08ul0.08ul
HPV_F (10pmole)0.1ul0.1ul
HPV_R (10pmole)1ul1ul
HPV16, 18 DNA4.5ul-
dH2O11.82ul16.32ul
Total20ul20ul


③ PCR 조건에 맞춰 기기를 세팅한다. 

단계온도시간사이클
초기 변성95℃ 12:001
변성94℃00:3040
결합50℃01:00
신장72℃00:30
최종 신장72℃05:001


4. 실험 결과


4. 실험 결과


5. 주의 사항


5. 주의 사항

1) 실험 도중 DNA나 PCR 시약이 오염되지 않도록 파이펫팅에 주의를 기울인다.

2) 실험 방법 중 온도나 시약 양을 틀리지 않게 주의하여 실험한다.


#HPV #Taq polymerase #dNTP




이경진 연구원


 경기도 수원시 영통구 대학4로 17 (이의동) 에이스광교타워1 3층 308호

Tel.(+82)031-899-8620 Fax.(+82)031-899-8621

E-mail. biomedux@biomedux.com




2 0