[Real Time PCR]#3 CT(Chlamydia trachomatis) 증폭 실험

관리자
2021-03-29
조회수 719

1. 개요 및 목적


1. 개요 및 목적

성병중 하나인 클라미디아 감염증을 유발시키는 클라미디아 트리코마티스 (Chlamydia trachomatis) 박테리아의 DNA를 이용해 실시간 중합효소 연쇄반응 (** Real time PCR)실험을 해보고 그 원리를 이해한다.

Chlamydia trachomatis란? 클라미디아로 일반적으로 알려진 클라미디아 트라코마티스는 클라미디아를 유발하는 박테리아(bacterium)로, 트라코마(Trachoma), 성병성림프육아종(Lymphogranuloma venereum), 비구 균성 요도염(Non-gonococcal urethritis), 자궁 경부염(Cervicitis), 난관염(Salpingitis), 골반 염증성 질환(Pelvic inflammatory disease) 등 다양한 방법으로 나타날 수 있다.

** Real Time PCR? PCR 증폭산물을 실시간으로 모니터링하여 정확한 정량이 가능하여 quantitave PCR이라고도 불린다. PCR의 1 cycle마다 DNA의 양이 2ⁿ(n=cycle수) 개념으로 증가하며 실시간으로 그래프가 그려진다. Conventional PCR은 전기영동을 통해 band의 유, 무를 확인하기 때문에 Real time PCR이 좀 더 민감도와 해상도가 높을 수 있다.

2. 실험 재료 및 기기


2. 실험 재료 및 기기

실험 재료

TaqMan Gene expression master mix, Primer set (Forward, Reverse, *Probe), Chlamydia trachomatis DNA, dH2O

* Probe란? Real time PCR 실험 시 한 쌍의 Primer set 외에 형광이 붙어있는 또 다른 primer를 넣어주게 된다. 여기에 붙어있는 형광은 PCR과정 중 결합단계에서 형광을 발하지 못하고 있다가 신장 단계에서 DNA 중합효소에 의해 probe에 붙어있던 형광이 떨어져 나오며 발광을 하게 된다. 이 때 나오는 형광을 측정하여 실시간으로 DNA양을 정량을 할 수 있다.


  • Primer 정보

F: GCGGGCGATTTGCCTTA

R: CGGTCAACGAAGAGGTTTTGTC

  • Probe 정보

P: CGGAGCGAGTTACG


실험 기기

Real time PCR (ex.QuantStudio5- Thermofisher)

3. 실험 방법 및 절차


3. 실험 방법 및 절차

Chlamydia trachomatis DNA를 10배씩 희석하여 준비한다.


Sample 1
Sample 2
Sample 3
Sample 4
Sample 5
DNA
2uL
Sample 1의 DNA 2uL
Sample 2의 DNA 2uL
Sample 3의 DNA 2uL
Sample 4의 DNA 2uL
dH20
18uL
18uL
18uL
18uL
18uL
Total
20uL
20uL
20uL
20uL
20uL


② PCR 샘플 시약 조성


Sample 1 ~ 5
NC
Master Mix
10uL
10uL
Primer Set
5uL 
5uL
CT DNA
3uL
-
dH20
2uL
5uL
Total
20uL
20uL


③PCR 조건에 맞춰 기기를 세팅한다.

단계
온도
시간
사이클
초기 변성
50℃
02:00
1
변성
95℃
10:00
1
결합
95℃
00:15
40
신장
60℃
01:00

*real-time PCR을 사용해서 그래프 결과를 얻기 때문에 최종신장과 4℃ 안정화 단계가 불필요하다.


④PCR이 끝난 후 그래프를 확인한다.

4. 실험 결과


4. 실험 결과

각 샘플의 그래프를 보고 Ct값을 통해 DNA의 발현여부나 양이 어느정도 존재하는지를 알 수 있다. Ct값은 DNA가 반응을 일으키는 최소의 양을 설정해(Threshold) 그 값과 증폭 그래프가 교차하는 지점의 Cycle 수를 말한다.

그래서 위 실험을 보면 각 Sample에 들어간 주형 DNA의 희석한 값에 따라 Ct값이 점점 뒤로 나타나게 된다.

이러한 그래프의 해석을 통해 다양한 유전자 발현의 해석, 또는 바이러스, 병원균의 검출 등 다양한 용도로 사용할 수 있다.

5. 주의 사항


5. 주의 사항

형광이 붙은 probe를 사용하기 때문에 빛이 과하게 노출되지 않게 조심한다.

DNA를 희석할 때 파이펫으로 정확한 양을 옮겨 희석할 수 있도록 주의한다.


#Chlamydia trachomatis #Real Time PCR #Quantitative PCR





이경진 연구원


 경기도 수원시 영통구 대학4로 17 (이의동) 에이스광교타워1 3층 308호

Tel.(+82)031-899-8620 Fax.(+82)031-899-8621

E-mail. biomedux@biomedux.com




3 8