[Real Time PCR]#4 Neisseria gonorrhoeae 증폭 실험

관리자
2021-04-02
조회수 541

목차

1.개요 및 목적

2. 실험 재료 및 기기

3. 실험 방법 및 절차

4. 실험 결과

5. 주의 사항

1. 개요 및 목적  


1. 개요 및 목적

임균(*Neisseria gonorrhoeae)은 전 실험의 Chlamydia trachomatis와 같이 대표적인 성병중에 하나인 임질을 일으키는 박테리아이다.

이 임균을 타겟으로 Real Time PCR을 진행해본다.

*Neisseria gonorrhoeae란? 두 개의 공모양을 하고 있는 쌍구균이다. 보통 성관계를 통해 전염되며 소변볼 때 따갑거나 진물이 나는 등의 증상을 보인다. 여성에게서는 무증상도 많으며 남성은 무증상이 거의 없다.

2.실험 재료 및 기기


2. 실험 재료 및 기기

실험 재료

TaqMan Gene expression master mix, Primer set (Forward, Reverse), Probe, Neisseria gonorrhoeae DNA, dH2O


  • Primer 정보

F: CCTTTGGTCTTGGTTTCCAACA

R: TCATAGCGATATGGAGCGTCAA

 

  • Probe 정보

P: CTCTGCTTCGGCTCT

 

실험 기기

Real Time PCR Systems (ex.QuantStudio5 - ABI, Thermo Fisher Scientific, USA)

3. 실험 방법 및 절차


3. 실험 방법 및 절차

Neisseria gonorrhoeae DNA를 10배씩 희석하여 준비한다.


Sample 1 
Sample 2
Sample 3
Sample 4
Sample 5
DNA
2uL
Sample 1의 DNA 2uL
Sample 2의 DNA 2uL
Sample 3의 DNA 2uL
Sample 4의 DNA 2uL
dH2O
18uL
18uL
18uL
18uL
18uL
Total
20uL
20uL
20uL
20uL
20uL


PCR 샘플 시약 조성


Sample 1~5
N.C.
Master Mix
10uL
10uL
Primer Set
5uL
5uL
NG DNA
3uL
-
dH2O
2uL
5uL
Total
20uL
20uL


PCR 조건에 맞춰 기기를 세팅한다.

단계
온도
시간
사이클
초기 변성
50℃
02:00
1
변성
95℃
10:00
1
결합
95℃
00:15
40
신장
60℃
01:00


PCR이 끝난 후 그래프를 확인한다.

4. 실험 결과


4. 실험 결과

5. 주의 사항


5. 주의 사항

형광이 붙은 probe를 사용하기 때문에 빛이 과하게 노출되지 않게 조심한다.

DNA를 희석할 때 파이펫으로 정확한 양을 옮겨 희석할 수 있도록 주의한다.

Sample의 각 조성을 모두 첨가 후 거품이 발생하지 않게 주의한다. 거품은 형광 신호 검출에 방해될 수 있다.

6. 관련 자료

#Neisseria gonorrhoeae #Real Time PCR #Quantitative PCR





이경진 연구원


 경기도 수원시 영통구 대학4로 17 (이의동) 에이스광교타워1 3층 308호

Tel.(+82)031-899-8620 Fax.(+82)031-899-8621

E-mail. biomedux@biomedux.com




4 0