[PCR]#7 Vibrio PCR 실험

이경진
2021-04-22
조회수 555


목차

1.개요 및 목적

2. 실험 재료 및 기기

3. 실험 방법 및 절차

4. 실험 결과

5. 주의 사항


1. 개요 및 목적  


1. 개요 및 목적

비브리오균은 대표적인 식중독의 원인균이고 또 장티푸스와 파라티푸스 등의 질병을 일으키는 병원균이다.

이 비브리오의 *유전자를 갖고 Real time PCR을 통해 이 병의 분자생물학적 검출 방법에 대해 알아볼 수 있다.

* 비브리오를 검출할 때 쓰는 주 타겟 유전자는 ToxR이라는 유전자이다. 이 유전자의 염기서열 내에서 프라이머와 프로브를 디자인한다.

 

2.실험 재료 및 기기


2. 실험 재료 및 기기

실험 재료

로슈 apta Taq DNA master mix, Vibrio Primer set (Forward, Reverse), Probe, Vibrio (ToxR) DNA, dH2O


  • Primer 정보

ToxR_F: TGCTTCTGATAACAATGACGCCT

ToxR_R: ACTGGCGCTTCTGGTTCAAC


  • Probe 정보

ToxR_P: AGCGACGCCTTCTGACGCAA-FAM


실험 기기

Real time PCR (ex.Quantstudio5-ThermoFisher)


3. 실험 방법 및 절차


3. 실험 방법 및 절차

① ToxR DNA를 10배씩 희석하여 준비한다.


Sample 1Sample 2Sample 3Sample 4Sample 5
Sample 6
DNAToxR 2ulSample 1의
DNA 2ul
Sample 2의
DNA 2ul
Sample 3의
DNA 2ul
Sample 4의
DNA 2ul
Sample 5의
DNA 2ul
dH2O18ul18ul18ul18ul18ul18ul
Total20ul20ul20ul20ul20ul20ul


② PCR 샘플 시약 조성 


Sample 1~6N.C.
Master Mix6ul6ul
Primer Set6ul6ul
ToxR DNA3ul-
dH2O5ul8ul
Total20ul20ul


③ PCR 조건에 맞춰 기기를 세팅한다.

단계온도시간사이클
변성50℃ 02:001
결합95℃ 00:3040
신장60℃ 01:00


④ PCR이 끝난 후 그래프를 확인한다.

 

4. 실험 결과


4. 실험 결과


5. 주의 사항


5. 주의 사항

①형광이 붙은 probe를 사용하기 때문에 빛이 과하게 노출되지 않게 조심한다.

②DNA를 희석할 때 파이펫으로 정확한 양을 옮겨 희석할 수 있도록 주의한다.

③Sample의 각 조성을 모두 첨가 후 거품이 발생하지 않게 주의한다. 거품은 형광 신호 검출에 방해될 수 있다.


#Vibrio #ToxR #Quantstudio5



이경진 연구원


경기도 수원시 영통구 대학4로 17 (이의동) 에이스광교타워1 3층 308호

Tel.(+82)031-899-8620 Fax.(+82)031-899-8621

E-mail.biomedux@biomedux.com



4 0