[PCR]#10 HSV PCR 실험

관리자
2021-06-04
조회수 478


목차

1.개요

2. 실험 재료 및 기기

3. 실험 방법 및 절차

4. 실험 결과

5. 주의 사항

1. 개요 


1. 개요

1) DNA 추출 키트를 이용하여 임상 검체로부터 게놈 DNA를 추출한다 (시약 미포함).

2) 본 진단키트를 사용하여 추출한 DNA로부터 비뇨생식기 감염 질환의 병원체 2종에 대한 표적 DNA를 증폭한다. 이때 시험시 마다 정도관리용 양성대조군과 음성대조군을 증폭하여 오염 여부를 확인한다.

3) 증폭된 PCR 산물을 전기영동하여 증폭된 산물을 확인한다.

3) 결과 판정은 음성대조군에서 증폭이 되지 않음을 확인하고 양성대조군과 동일한 size의 band의 증폭 산물이 확인되면 병원체 감염을 확인할 수 있다.

4) 병원체 검출 여부를 판정한다. 병원체 검출 여부 판정은 2종의 병원체별로 이루어진다.

2.실험 재료 및 기기


2. 실험 재료 및 기기

실험 재료

PCR Premix, Primer mix, 증류수(DNase free)

  • Primer 정보

HSV1 Forward: ATCCTCGCTTTAGGAACAACT

HSV1 Reverse: CCAACTGCCCCCTTATCTA

HSV2 Forward: CGAAGACAGCTGCGTTCCC

HSV2 Reverse: TTCGCTTCATCGCCACGAAG


실험 기기

Conventional PCR (ex.Veriti® Thermal Cycler -> Applied Biosystems, 미국)

DNA Electrophoresis (ex.MyGeldoc -> 랩지노믹스, 한국)

3. 실험 방법 및 절차

3. 실험 방법 및 절차

3.1. DNA 추출 과정

DNA 추출키트를 이용하여 인체 유래물로부터 total DNA를 추출한다.

추출된 DNA는 곧바로 PCR에 사용이 가능하며 장기간 보존 시에는 –20℃ 이하에 보관한다.

추출한 DNA의 농도는 5-100 ng/㎕ 이어야 하며 순도는 A260/A280 ratio가 1.6~2.0인 검체를 사용한다.

3.2. 바이러스 2종 반응을 위한 PCR 반응 과정

PCR 혼합액을 준비한다. PCR 혼합액은 검체 1개 기준으로 다음 표의 조성으로 각 시약을 혼합하여 준비한다. 이때 각 시약의 사용량은 대조군(양성대조군, 음성대조군)을 포함한 검체의 반응수에 따라 필요한 양을 계산한다.


첨가시약용량 (검체 1개 기준)
PCR Premix10 ㎕
Primer Mix4 ㎕
D.W3 ㎕
Total17 ㎕


준비한 PCR 혼합액은 5회 정도 가볍게 섞어주거나 vortexing한 후 가볍게 원심분리한다.

PCR 튜브에 PCR 혼합액을 17 ㎕씩 분주한다. (분주 후에는 바로 뚜껑을 닫아 오염을 방지한다.)

튜브에 임상검체에서 추출한 template DNA 3 ㎕를 첨가한다. (양성대조군에는 제공되는 양성대조군 DNA를, 음성대조군에는 D.W를 첨가한다.)


첨가시약용량 (검체 1개 기준)
PCR 혼합액17 ㎕
template3 ㎕
Total20 ㎕


각 혼합액 튜브는 30초간 원심분리 후, PCR 장치에 넣어 아래와 같이 반응시킨다.


과정온도시간사이클
UDG-treatment37℃02:001
Pre-Denaturation95℃15:001
Denaturation95℃00:3040
Annealing57℃00:40
Extension72℃01:00
Final-Extension72℃05:001
End4℃

 4. 실험 결과


4. 실험 결과

5. 주의 사항


5. 주의 사항

실험 도중 DNA나 PCR 시약이 오염되지 않도록 파이펫팅에 주의를 기울인다.

실험 방법 중 온도나 시약 양을 틀리지 않게 주의하여 실험한다.








1 0