[PCR]#13 SARS CoV-2 : N gene single RT-LAMP

문정원
2021-08-11
조회수 224


목차

1.개요 및 목적

2. 실험 재료 및 기기

3. 실험 방법 및 절차

4. 실험 결과

5. 주의 사항

6. 관련 자료


1. 개요 및 목적

SARS CoV-2의 N gene이 target gene으로 적절한지 확인하기 위하여 single RT-LAMP를 진행한다.


2. 실험 재료 및 기기

: QuantStudio5(ABI 기기)


● Primer 및 Probe 정보

Target

Name

Sequence(5’ → 3’)

Length

SARS CoV-2 (N gene)

N F3

TGGACCCCAAAATCAGCG

18

N B3

GCCTTGTCCTCGAGGGAAT

19

N FIP

CCACTGCGTTCTCCATTCTGGTAAATGCACCCCGCATTACG     

41

N BIP

CGCGATCAAAACAACGTCGGCCCTTGCCATGTTGAGTGAGA

41

N BLP

GGTTTACCCAATAATACTGCGTCTT

25

N FLP

TGAATCTGAGGGTCCACCAAA

21

N BLP

Probe2

[Cy5]- GTCAGTGCAGGCTCCCGTGTTAGGACGAGGGTAGGGGTTTACCCAATAATACTGCGTCTT

60

Quencher probe 2

CCTACCCTCGTCCTAACACGGGAGCCTGCACTGAC-[BHQ2]

35



3. 실험 방법 및 절차

● N gene Primer Mix 100µℓ 제조

Reagent

Volume

F3

4 µℓ

B3

4 µℓ

FIP

3.3 µℓ

BIP

3.3 µℓ

LF

10 µℓ

LB

4 µℓ

LB probe

6 µℓ

DW

65.4 µℓ

Total Volume

100 µℓ


● N gene RT-LAMP 시약 조성

Reagent

Volume

2x Reaction buffer

12.5 µℓ

Enzyme mix

2.0 µℓ

Primer mix

1.2 µℓ

Quencher2 solution

0.06 µℓ

RNA template

2.5 µℓ

DW

6.74 µℓ

Total Volume

25 µℓ


  • 10^6 [copy/µℓ]의 template stock을 10배씩 10^0 [copy/µℓ]까지 희석한다.
  • 3개의 positive control과 1개의 negative control(총 4개)을 위해, RNA template를 제외한 나머지 시약으로 pre-mixture을 1개의 여분까지 포함하여 5개의 분량(22.5 µℓ x 5=112.5µℓ)으로 제조한 후 mixing&spin down 시킨다.
  • 총 4개의 튜브에 pre-mixture을 22.5 µℓ씩 넣어준다.
  • 3개의 튜브에만 covid19의 RNA template를 2.5 µℓ 넣어준 후, 1개의 튜브에는 2.5 µℓ 만큼의 DW를 넣어 시약을 완성시킨다.
  • QuantStudio5(ABI 기기)에 시약이 든 튜브들을 넣고 RT-LAMP를 60°C, 40분의 조건으로, 리포터로서 Cy5 dye를 선택한 뒤 증폭 및 정량 분석(Ct값 측정)을 시작한다.


4. 실험 결과


Template 농도 [copy/µℓ]

Ct값

10^6

20.14

10^6

20.46

10^6

20.52

0(Negative Control)

Undetermined



5. 주의 사항

1) 실험 도중 RNA나 PCR 시약이 오염되지 않도록 파이펫팅에 주의를 기울인다.

2) 실험 방법 중 온도나 시약 양을 틀리지 않게 주의하여 실험한다.



6. 관련 자료

Development of a multiplex Loop-Mediated Isothermal Amplification (LAMP) assay for onsite diagnosis of SARS CoV-2




문정원 인턴



3 0