[PCR]#15 Human DNA 추출 및 증폭 실험

조회수 8470


1.개요 및 목적

2. 실험 재료 및 기기

3. 실험 방법 및 절차

4. 실험 결과

5. 주의 사항

1. 개요 및 목적  

1. 개요 및 목적

사람의 구강상피세포, 모근, 소변 등 여러 시료에 대하여 DNA 추출을 하며 DNA의 기본적인 추출과정과 원리에 대해 배울 수 있다.

이렇게 추출된 DNA는 사람의 미토콘드리아내의 매우 보존적인 염기서열을 갖고 있는 16SrRNA를 이용하여 증폭실험을 진행하며,

그 결과를 전기영동 실험을 통해 확인한다.

2.실험 재료 및 기기

2. 실험 재료 및 기기


-Sample Preparation solution

-2X PCR Master mix

-16SrRNA Forward primer (CAATTGGACCAATCTATCACC:21mer)

-16SrRNA Reverse primer (GTGAGGGTAATAATGACTTGT:21mer)

-추출된 DNA

-Positive DNA


-50bp DNA Ladder


- Conventrional PCR (본 실험에서 사용한 기기 → DuxCycler (주)바이오메듀스, 한국)

- 전기영동 장치 (본 실험에서 사용한 기기 → Power Supply - BIO-RAD, 미국 / gel tray-(주)바이오니아, 한국) 

- Gel 이미지 영상처리 장치 (본 실험에서 사용한 기기 → DuxGelDoc - (주)바이오메듀스,한국) 

- Heat block (본 실험에서 사용한 기기 → Allsheng Instrument)

3. 실험 방법 및 절차

3. 실험 방법 및 절차

< 시료 채취 >

구강상피세포: 식염수로 1분정도 입안을 강하게 헹궈서 구강상피세포를 추출하여 1ml tube에 담아준다.

모근: 머리카락을 몇가닥 뽑아 모근의 부분만 tube에 모아준다.

소변: 종이컵에 소변을 받아 1ml tube에 넣어준다.

<DNA 추출 >

1. 원심분리기의 최대속도로 1분간 원심분리한 후 약간의 용액만 남기고 상층액을 버려준다.

(모근의 경우 이 과정을 생략)

2. 시료전처리액을 각 50ul씩 넣어 볼텍스믹서를 통해 수초간 섞어준다.

3. 원심분리기로 tube 벽면의 시료를 바닥으로 떨어뜨린 후 핫블럭이나 PCR기기를 통해 95℃, 10분간 처리해준다.

4. 처리한 시료를 원심분리기 최대속도로 1분간 원심분리한 후 상층액을 새로운 튜브에 옮겨 담는다.

(마지막 과정이 번거롭다면 원심분리를 생략하고 시료의 위부분을 살짝 따서 사용하여도 좋다)

<DNA 증폭 실험>

1. 샘플 준비

번호시약명Tube1Tube2 (PC)Tube3 (NC)
12X PCR Master mix10ul10ul10ul
2Forward primer1ul1ul1ul
3Reverse primer1ul1ul1ul
4추출 DNA3ul--
5Positive DNA-3ul-


*PC는 Positive Control (양성대조군), NC는 Negative Control (음성대조군)을 말한다.

  2. PCR 조건

단계온도시간반복 사이클
초기 변성95도5:001
최종 신장72도5:001



1. 완충용액(TAE or TBE buffer)이 담긴 전기영동 탱크에 준비된 Agarose gel을 설치한다.

2. 증폭된 DNA 산물 5㎕, 6X loading dye 1㎕를 혼합하여 Micropipette으로 Agarose gel 주입 홈(well)안에 주입한다.

3. 한 well에는 상품화된 DNA size marker(DNA Ladder)를 주입하여, DNA band의 크기를 비교 확인 할 수 있다.

4. power supply를 연결하여 250v에서 ⊝→⊕ 방향으로 전기를 걸어준다.

(DNA 밴드가 gel의 약 2/3 지점까지 끌리면 멈춘다)

5. 전기영동된 gel을 nucleic acid stain 처리를 한다.(Loading star 사용 시 증폭산물과 혼합하여 Agarose gel well에 주입하여 전기영동 하므로 이 단계를 생략한다.)

(보통 EtBr 용액에 약 20분간 넣어두지만 EtBr이 인체에 유해하므로 대체상품(권장상품: Loading Star(제조사: DyneBio))을 사용할 것을 권장한다.)

6. Gel-Doc 시스템을 사용하여 band를 확인한다.

4. 실험 결과

4. 실험 결과

-M: 50bp Ladder

-1~5: 소변에서 추출한 DNA (16SrRNA: 157bp)

-6~10: 머리카락에서 추출한 DNA

-11~15: 구강세포에서 추출한 DNA

-P: Positive Control

-N: Negative Control

*사람마다 추출된 DNA의 양이 다르므로 밴드의 두께가 다 다를 수 있다.

5. 주의 사항

5. 주의 사항

- 음성대조군에 밴드 형성: 실험 도구 및 테이블을 소독하여 오염원을 제거한다.

- 맞지 않는 위치에 밴드 형성: 잘못된 실험이므로 다시 실험을 진행한다.

6. 관련 자료

#Conventional PCR #16SrRNA gene #구강상피세포 

* 본 실험에 사용된 Human DNA 추출, 증폭 실험은 (주)바이오메듀스의 교육용 PCR Kit를 사용했습니다.


경기도 수원시 영통구 대학4로 17 (이의동) 에이스광교타워1 3층 308호

Tel.(+82)031-899-8620 Fax.(+82)031-899-8621

E-mail. leekj87@biomedux.com

4 0